Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR604 IGR603 IGR599 IGR602 IGR598 IGR605 IGR601 IGR600 IGR606 rs20, - CPn0754 CPn0753 recA, - CPn0762 CPn0761 CPn0760 CPn0755 folP, - CPn0758 recD, - CPn0752 rpoD, - CPn0756 rs20, - CPn0754 CPn0753 recA, - CPn0762 CPn0761 CPn0760 CPn0755 folP, - CPn0758 recD, - CPn0752 rpoD, - CPn0756 rs20, - CPn0754 CPn0753 recA, - CPn0762 CPn0761 CPn0755 folP, - CPn0758 recD, - CPn0752 rpoD, - CPn0756 folX, - CPn0757 folA, - CPn0759 folX, - CPn0757 folA, - CPn0759 CPn0760

IGS ID: IGR602

DNA Molecule Name:
1  

IGS Start:
854680

IGS Stop:
854732

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TCTTTGAGTAAAAGGTTCGTTTTTTATAGCCTTGTATAAAAAATATTGCT
CTG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy