Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA_Pro_2 IGR594 IGR599 IGR592 IGR598 IGR595 IGR597 IGR596 IGR600 IGR591 IGR593 CPn0745 rs20, - CPn0754 glmU, - CPn0749 tctD, - CPn0750 CPn0753 ispA, - CPn0748 recD, - CPn0752 CPn0746 CPn0751 CPn0745 rs20, - CPn0754 glmU, - CPn0749 tctD, - CPn0750 CPn0753 ispA, - CPn0748 recD, - CPn0752 CPn0746 CPn0751 CPn0745 rs20, - CPn0754 glmU, - CPn0749 tctD, - CPn0750 CPn0753 ispA, - CPn0748 recD, - CPn0752 CPn0746 CPn0751

IGS ID: IGR596

DNA Molecule Name:
1  

IGS Start:
846412

IGS Stop:
846607

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATGAAAACAAAATAGATTATATGAATGAATACGTAATATAAAATCAGTTA
TTTTTCAAAGGTCACTTACACTTTTTTACTTTTTTCTTTTTTGAAAAATA
GTTTTGCATAAACACAACACTATATATATAATTTAAAATTAATAATTTAG
AAGCGACATAGTTTTTTAACTTCTTTGAAGGCCGTTCAGGACGTAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy