Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA_Pro_2 IGR594 IGR590 IGR589 IGR592 IGR595 IGR588 IGR596 IGR591 IGR593 CPn0745 glmU, - CPn0749 tctD, - CPn0750 ispA, - CPn0748 hemB, - CPn0744 greA, - CPn0741 CPn0742 nqrA, - CPn0743 CPn0746 CPn0751 CPn0745 glmU, - CPn0749 tctD, - CPn0750 ispA, - CPn0748 hemB, - CPn0744 greA, - CPn0741 CPn0742 nqrA, - CPn0743 CPn0746 CPn0751 CPn0745 glmU, - CPn0749 tctD, - CPn0750 ispA, - CPn0748 hemB, - CPn0744 greA, - CPn0741 CPn0742 nqrA, - CPn0743 CPn0746 CPn0751

IGS ID: IGR592

DNA Molecule Name:
1  

IGS Start:
841904

IGS Stop:
841974

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTAAGCAAGTTTATATTATCCGAGTATATTAGTAGTTTTCGGGAAGATGT
CCGTTCAGTTTTGAGGTTTTC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy