Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR47 IGR48 IGR46 IGR51 IGR45 IGR49 IGR44 IGR53 IGR54 IGR52 IGR50 CPn0063 CPn0064 dut, - CPn0059 ptsN, - CPn0060 sodM,sodA, - CPn0057 ptsN, - CPn0061 accD, - CPn0058 CPn0062 CPn0065 CPn0066 CPn0063 CPn0064 dut, - CPn0059 ptsN, - CPn0060 sodM,sodA, - CPn0057 ptsN, - CPn0061 accD, - CPn0058 CPn0062 CPn0065 CPn0066 CPn0064 dut, - CPn0059 ptsN, - CPn0060 sodM,sodA, - CPn0057 ptsN, - CPn0061 accD, - CPn0058 CPn0062 CPn0065 CPn0066 CPn0063

IGS ID: IGR50

DNA Molecule Name:
1  

IGS Start:
77694

IGS Stop:
78111

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTGTATAGCCCTTGCTGGACGTGTAGCTCTACCCAAAATCTTAGATAGCC
TTCTTATCTATGATTTTAGTGGGTAGAGCTTTCCCTCCCGACTCGTCTTC
TTTTCAATTTTCTCTTTGTAATTACACTTTATCTCTCTTTCTATCTTTTT
CGGGAGTACCTTCTTATTTTAGATAGAGAAAGCTTAGTTTTTCTTTTGTT
TAAGAAATAATTATAAGCTCGTTAATATAATCAATTTGCCTTTAAGTAAA
ATGATAAAACTATCTAATCTATAGTGATTTGTGTTGTATAGCATTATTAT
ATTGCATCGTGTCAGATTTGCGTGTTCATTCTAGGGGAACACCGACCCAG
ACTCATAGTGAGATCTGTGATGCCCATCCTACCAACAGATTTTTGAAAAA
ACACCCTACACTTGACCT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy