Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR7 IGR4 IGR3 IGR5 IGR6 CPn0006 CPn0008 CPn0009 gatB, - CPn0004 pmpG, - CPn0005 CPn0007 CPn0006 CPn0008 CPn0009 gatB, - CPn0004 pmpG, - CPn0005 CPn0007 Type: tandem, Name:  - 1 Type: direct, Name:  - 14 Type: direct, Name:  - 14 Type: direct, Name:  - 16 Type: direct, Name:  - 16 CPn0006 CPn0008 CPn0009 gatB, - CPn0004 pmpG, - CPn0005 CPn0007

IGS ID: IGR5

DNA Molecule Name:
1  

IGS Start:
7294

IGS Stop:
7604

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
CTGCTTCTAAGTAAAAATCTAAAGAGAAGTCTAGTTTTTTCGATACATTG
ACTTCTTTTTTGAAACCAGACACTCATTGCTAGCCGAATTTTAAGAGTCC
ATGAGCATGATTTCTGTAAAATCCTCGCAATGAGCTTTTTGTCTTCTCAC
CTTATGATGTGCTTTCTATAAGTATTTAAATGAACTTTTATTAAAAGAGT
TTTCGCTATAACCTTTCGCTCATTTTTTCCTTTCTTGTCGTGATACCGCT
AACTGATAGCACTACAAGCTCTCTTTCAACGTCTCTCTTAGATGAAGGAA
ACCCACAATCC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy