Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA_Leu_3 IGR489 IGR494 IGR492 IGR495 IGR496 IGR493 IGR497 IGR488 IGR490 IGR491 rs13, - CPn0628 rs11, - CPn0627 rl17, - CPn0625 ndk, - CPn0619 ruvC, - CPn0621 ruvA, - CPn0620 CPn0623 CPn0622 gapA, - CPn0624 rpoA, - CPn0626 secY, - CPn0629 gidA, - CPn0617 rs13, - CPn0628 rs11, - CPn0627 rl17, - CPn0625 ndk, - CPn0619 ruvC, - CPn0621 ruvA, - CPn0620 CPn0623 CPn0622 gapA, - CPn0624 rpoA, - CPn0626 secY, - CPn0629 gidA, - CPn0617 rs13, - CPn0628 rs11, - CPn0627 rl17, - CPn0625 ndk, - CPn0619 ruvC, - CPn0621 ruvA, - CPn0620 CPn0623 CPn0622 gapA, - CPn0624 rpoA, - CPn0626 secY, - CPn0629 gidA, - CPn0617 lplA, - CPn0618 lplA, - CPn0618

IGS ID: IGR491

DNA Molecule Name:
1  

IGS Start:
715753

IGS Stop:
716159

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AGAGTACCTCTAAAATTAACCTAATCATTCATCGTATAGCATACGACTGA
GTTCTTGTCCTAATTCGTCATAAGTGACTTTTAAAAAGACAGGCAACTTA
TTTGGATAACTCTACAGATTAAAAAACTTAGAAAATTGCTCAGAACAAGA
CTCGAACTTGCACGGGCCTACGCCCAAGGGATTTTAAGTCCCTAGTGTCT
ACCATTCCACCATCTGAGCACGAAAAGACAGTCTGTTCAGAGAAGCCTTC
AATTAAAAGGCGTGTTCTTTAAAGATGATCTTTTTCCATAAGGATAGAAA
ACTAAAGAACATCTTATCACAGTTTTTTTTCTAGATCAATGATTTTTCAA
AAAAGGGAAAGGTATGCCTTAAGTTAAAGTGAACTTAAACCATACCTTTA
AAAATAG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy