Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR47 IGR48 IGR46 IGR45 IGR49 IGR42 IGR44 IGR43 IGR50 radA,sms, - CPn0053 dut, - CPn0059 CPn0055 ptsN, - CPn0060 sodM,sodA, - CPn0057 ptsN, - CPn0061 accD, - CPn0058 CPn0062 mrsA, - CPn0056 radA,sms, - CPn0053 dut, - CPn0059 CPn0055 ptsN, - CPn0060 sodM,sodA, - CPn0057 ptsN, - CPn0061 accD, - CPn0058 CPn0062 mrsA, - CPn0056 radA,sms, - CPn0053 hemC, - CPn0052 rnc, - CPn0054 hemC, - CPn0052 rnc, - CPn0054 dut, - CPn0059 CPn0055 ptsN, - CPn0060 sodM,sodA, - CPn0057 ptsN, - CPn0061 accD, - CPn0058 CPn0062 mrsA, - CPn0056

IGS ID: IGR44

DNA Molecule Name:
1  

IGS Start:
72750

IGS Stop:
72933

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GTGGAAAAATCATCTTGGAGAATATCCTAAAGCTATTTACACTTGGGCTA
AATCTCCTTCAGAATAAGGCCTTCTTTCAAGGCCATTGTTGTATCCGAAA
CAAGGTTGAGTAGAGTACTTGCTTTCCTAGCAAAACTTTCTGAACTTAAA
TCAAGGAGGTTAAATACTAAAAAGGTATGTTGTT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy