Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR401 IGR399 IGR402 IGR398 IGR400 IGR397 CPn0499 3mgh, - CPn0505 CPn0506 hrcA, - CPn0501 proS, - CPn0500 dnaK, - CPn0503 vacB, - CPn0504 CPn0499 3mgh, - CPn0505 CPn0506 hrcA, - CPn0501 proS, - CPn0500 dnaK, - CPn0503 vacB, - CPn0504 CPn0499 CPn0506 hrcA, - CPn0501 proS, - CPn0500 dnaK, - CPn0503 vacB, - CPn0504 grpE, - CPn0502 grpE, - CPn0502 3mgh, - CPn0505

IGS ID: IGR399

DNA Molecule Name:
1  

IGS Start:
584205

IGS Stop:
584233

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAATAACCCCTAGAGATTAGGTACCAAAC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy