Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR395 IGR399 IGR398 IGR396 IGR400 IGR397 CPn0498 CPn0499 CPn0496 hrcA, - CPn0501 proS, - CPn0500 dnaK, - CPn0503 vacB, - CPn0504 CPn0498 CPn0499 CPn0496 hrcA, - CPn0501 proS, - CPn0500 dnaK, - CPn0503 vacB, - CPn0504 CPn0498 CPn0499 CPn0497 CPn0497 CPn0496 hrcA, - CPn0501 proS, - CPn0500 dnaK, - CPn0503 vacB, - CPn0504 grpE, - CPn0502 grpE, - CPn0502

IGS ID: IGR398

DNA Molecule Name:
1  

IGS Start:
582366

IGS Stop:
582456

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
CTCTTTGATCGCTGCCCTCCTCGTAAAAAAGTTAGCATTCATTCAATTCG
AGTGCTAAATTCTCTTGACCTTCTCGGGTTCTTTTCCTATA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy