Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR395 IGR392 IGR398 IGR393 IGR396 IGR394 IGR397 IGR391 CPn0493 CPn0494 CPn0498 CPn0491 CPn0499 CPn0492 aspC, - CPn0495 hrcA, - CPn0501 proS, - CPn0500 CPn0493 CPn0494 CPn0498 CPn0491 CPn0499 CPn0492 aspC, - CPn0495 hrcA, - CPn0501 proS, - CPn0500 CPn0494 CPn0498 CPn0491 CPn0499 CPn0497 CPn0497 CPn0493 CPn0492 aspC, - CPn0495 hrcA, - CPn0501 proS, - CPn0500 grpE, - CPn0502 CPn0496 grpE, - CPn0502 CPn0496

IGS ID: IGR396

DNA Molecule Name:
1  

IGS Start:
579036

IGS Stop:
579201

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAAGGGCGCCCTCCTTAATCGGCAATATTAGACGCCACCATATAACAAAA
ATTCAAAAAAACAATAAACAAACCACCGCAATTTGAACTATAAAAATAGG
ACTGGGTGAGAGTAAAAGCTGGCAATTCTGATTCGATAGTTTCTACTCAG
AAGAGATCATTCTTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy