Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR395 IGR392 IGR393 IGR396 IGR394 IGR397 IGR391 IGR390 CPn0493 CPn0494 CPn0489 CPn0498 CPn0491 CPn0499 CPn0492 aspC, - CPn0495 CPn0490 CPn0493 CPn0494 CPn0489 CPn0498 CPn0491 CPn0499 CPn0492 aspC, - CPn0495 CPn0490 CPn0494 CPn0489 CPn0498 CPn0491 CPn0499 CPn0497 CPn0497 CPn0493 CPn0492 aspC, - CPn0495 CPn0490 CPn0496 CPn0496

IGS ID: IGR394

DNA Molecule Name:
1  

IGS Start:
575365

IGS Stop:
575602

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AATTACCTAAAAAATTTTTTCAAATCTTATCCTTTAATTATAGTGAGCAA
ATTAGAAAAGATTTAAAAAACTTTTAATAAACAGAATTATAAATATATCT
TAATAATTAACCGAAACTACAGAGCACTCCTTGCCTTTATAGAGGCGGTT
AAAGAAAAATCAGAAAATGGCTATCCAAAAAGCTGGGGCTTTCTTAAGAT
GTCTTCCAAGTGAATCACGCCCTTACCTGGAGCACGCT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy