Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR38 IGR40 IGR37 IGR42 IGR41 IGR36 IGR39 IGR43 CPn0050 CPn0049 radA,sms, - CPn0053 CPn0047 CPn0051 CPn0055 CPn0045 mrsA, - CPn0056 CPn0048 CPn0050 CPn0049 radA,sms, - CPn0053 CPn0047 CPn0051 CPn0055 CPn0045 mrsA, - CPn0056 CPn0048 CPn0049 radA,sms, - CPn0053 hemC, - CPn0052 rnc, - CPn0054 hemC, - CPn0052 rnc, - CPn0054 CPn0050 CPn0051 CPn0055 CPn0045 mrsA, - CPn0056 CPn0048 CPn0046 CPn0047 CPn0046

IGS ID: IGR39

DNA Molecule Name:
1  

IGS Start:
66297

IGS Stop:
66495

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AGTAAGCCAAAAAATTTCTTGATAGATAACTAGCAGGTAAACGATATTCC
TTCTTTTCTCTTTCAGTCAATGGTATTTTTTATAAGTCACTAAGAATAAA
AACTCATAAAGATGGTCTAGCTTCGCTTTGCTTATTTTTAACTTCTACAG
TGTCTAAAGGGGAAGAAATGTAGTAAAAGACTACAAATGAGACATGCAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy