Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR341 IGR337 IGR339 IGR340 IGR336 IGR338 IGR335 CPn0426 CPn0421 pbp2,penA, - CPn0419 CPn0423 CPn0422 CPn0425 nqr3, - CPn0428 dnaA, - CPn0424 nqr2, - CPn0427 CPn0426 CPn0421 pbp2,penA, - CPn0419 CPn0423 CPn0422 CPn0425 nqr3, - CPn0428 dnaA, - CPn0424 nqr2, - CPn0427 CPn0426 CPn0421 pbp2,penA, - CPn0419 CPn0420 CPn0420 CPn0422 CPn0425 nqr3, - CPn0428 dnaA, - CPn0424 nqr2, - CPn0427 CPn0423

IGS ID: IGR338

DNA Molecule Name:
1  

IGS Start:
469220

IGS Stop:
469611

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTTTTTCTCCTATAGAAAACGTATTTCGTGATTGAAGAACTCCGGATTTC
TTTAGTTCTTTTTCCATTTTTATTACAAAATTTCATAATTATTTTTTCCT
GAATTTGTGGTTCCTTATTGCCTAACGAAACCAACGATCCAATTTGCCTT
AAAACCTAGTAATCGGTAGAGTTATTTTATCGGCAGAGCGTACCGCGTTT
ACCTGCGGAGGAAGGGTGTATAGGATCCATTCCTAACAGGAACTTCACCC
AGGGAATGCAGGATCCAATCTGAACGCGAAGAGTCATTGCACTCAGTGCA
ATGAATAGTCAAGATGCAATGAGATTTTCTCGCCATCACTCATGGGATGG
GTCGATTGTATTTGGGAAAGCTTTATAAATAAAGAGAGCGGC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy