Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR323 IGR326 IGR331 IGR328 IGR327 IGR324 IGR329 IGR330 CPn0401 CPn0405 CPn0407 CPn0404 mutY, - CPn0402 CPn0408 CPn0409 CPn0399 yceC, - CPn0403 CPn0400 CPn0411 fabI, - CPn0406 CPn0401 CPn0405 CPn0407 CPn0404 mutY, - CPn0402 CPn0408 CPn0409 CPn0399 yceC, - CPn0403 CPn0400 CPn0411 fabI, - CPn0406 Type: tandem, Name:  - 6 CPn0401 CPn0405 CPn0407 CPn0404 mutY, - CPn0402 CPn0408 yceC, - CPn0403 CPn0400 fabI, - CPn0406 dnaQ, - CPn0410 CPn0411 CPn0399 dnaQ, - CPn0410 CPn0409

IGS ID: IGR328

DNA Molecule Name:
1  

IGS Start:
450888

IGS Stop:
450962

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GGTATCAATGCCAAGCTCACTTAACGCAATTAAAAGAACAGCCTTGCCAT
ATTTCTGTTCTAAAGCCTCGAGTTC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy