Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA_Pro_1 IGR292 IGR291 IGR294 IGR290 IGR295 IGR296 IGR293 IGR297 rpsD, - CPn0362 tyrS, - CPn0361 gnd, - CPn0360 flhA, - CPn0363 fer, - CPn0364 CPn0365 lepA, - CPn0359 rpsD, - CPn0362 tyrS, - CPn0361 gnd, - CPn0360 flhA, - CPn0363 fer, - CPn0364 CPn0365 lepA, - CPn0359 Type: tandem, Name:  - 5 rpsD, - CPn0362 tyrS, - CPn0361 gnd, - CPn0360 flhA, - CPn0363 fer, - CPn0364 CPn0365 lepA, - CPn0359

IGS ID: IGR293

DNA Molecule Name:
1  

IGS Start:
406648

IGS Stop:
407051

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GCTCTATCTTATCGATCCTAAAGCTTATATGCAAGGCACCACCTATCTAA
CAATAAAGAAAAGATTGTACGCTGAGAATAATTCCTTTGCTGAGATACCA
TAACTTCTATCTTCTCTAAAGATTAGGTCGCTATGTCTACATCTCCAATT
GGGGTTCCGTCGATGCTAAACGCCGCAACTAGTCTAAATGCCACAACTAG
CAAGGCACCCCTTCCTACCTCTACCCTAGCCGAACGTATTAAAGAATGGC
TGCCCCGCATTCTTCTCTTGATTGTAGGAGCAATCTTCACAATTGCTGGC
TGCATTGTTATGGCGTTGACTAAACAAATTCTTTACGGATTACTCTGTGT
CGTAGGAGGGCTTCTCCTAGCTCTAGGACTGCTCTTAAAACCTGAGAACT
GTAT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy