Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR280 IGR285 IGR284 IGR279 IGR283 IGR282 IGR281 ytgD,troD, - CPn0346 ytgA,troA,adhS, - CPn0349 yaeM, - CPn0345 ytgC,troC, - CPn0347 CPn0353 CPn0350 CPn0352 CPn0354 adt, - CPn0351 ytgD,troD, - CPn0346 ytgA,troA,adhS, - CPn0349 yaeM, - CPn0345 ytgC,troC, - CPn0347 CPn0353 CPn0350 CPn0352 CPn0354 adt, - CPn0351 ytgD,troD, - CPn0346 ytgA,troA,adhS, - CPn0349 yaeM, - CPn0345 ytgC,troC, - CPn0347 ytgB_1,troB, - CPn0348 ytgB_1,troB, - CPn0348 CPn0350 CPn0352 CPn0354 adt, - CPn0351 CPn0353

IGS ID: IGR281

DNA Molecule Name:
1  

IGS Start:
392771

IGS Stop:
393180

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
CTCTCTAGAAGCATTTTTTAAGATCCATTAAAAACCACTTAAAGTACCAG
AAAAACAAGTTCTATTCAAAATATATTTTATCCAGCAAGAAATACAACTA
ATAGAAATGAAAGAAATATCTTTGTTCAGGATAGTTTTAAAAAAATTAGA
AAACCCGTTTGTTTTATAAGAAAACAAAATGTTATAGAAAAAATCTTCTT
TACTTTACGATTTTTATGTTTTGAATTTTGTTAAGAAACAAAAAGATCCT
GAGAGGAAAAATATTGCAAAAAGGAGAACTTGCAATATAATTTATGTTCG
CTGATTGATTAAAACAGCGCTTTAATTTTATTTCTCTAAACATTAAATTG
AAAGTATGCCACATTCTTTCTTGTAAAATATGTAAGCATCAATTATAAAA
GGTGGGTTTC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy