Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR278 IGR277 IGR273 IGR277.1 IGR274 IGR275 IGR276 CPn0332 ltuB, - CPn0333 smpB, - CPn0337 yaeM, - CPn0345 CPn0331 yaeL, - CPn0344 CPn0334 yojL, - CPn0336 CPn0340 recF, - CPn0339 dnaN, - CPn0338 CPn0332 ltuB, - CPn0333 smpB, - CPn0337 yaeM, - CPn0345 CPn0331 yaeL, - CPn0344 CPn0334 yojL, - CPn0336 CPn0340 recF, - CPn0339 dnaN, - CPn0338 Type: tandem, Name:  - 4 smpB, - CPn0337 yaeM, - CPn0345 CPn0331 yaeL, - CPn0344 ltuB, - CPn0333 CPn0332 yojL, - CPn0336 CPn0340 recF, - CPn0339 dnaN, - CPn0338 folD, - CPn0335 folD, - CPn0335 CPn0334

IGS ID: IGR277

DNA Molecule Name:
1  

IGS Start:
383379

IGS Stop:
383425

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAACTCCCTAAGGAGAATCCTTTAGGTCACTACCCTGCCGATGTTT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy