Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR272 IGR277 IGR271 IGR270 IGR273 IGR274 IGR275 IGR276 CPn0332 ltuB, - CPn0333 smpB, - CPn0337 CPn0330 CPn0331 CPn0334 yojL, - CPn0336 CPn0329 recF, - CPn0339 dnaN, - CPn0338 CPn0328 CPn0332 ltuB, - CPn0333 smpB, - CPn0337 CPn0330 CPn0331 CPn0334 yojL, - CPn0336 CPn0329 recF, - CPn0339 dnaN, - CPn0338 CPn0328 Type: tandem, Name:  - 4 ltuB, - CPn0333 smpB, - CPn0337 CPn0330 CPn0331 CPn0332 yojL, - CPn0336 CPn0329 recF, - CPn0339 dnaN, - CPn0338 CPn0328 folD, - CPn0335 folD, - CPn0335 CPn0334

IGS ID: IGR275

DNA Molecule Name:
1  

IGS Start:
379091

IGS Stop:
379310

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAAAAATACAAAAACAAAAAAATCAACTTAATAAACTAATTTTAATTAAA
AAACTTATTAAGAATAAACTAATTTTAATCTAAAAATAAAATATTATATA
AATAATTGTTTAAAAGCAGTTTAGATAAACATAAAAAATCAAGCTAAGAA
TCCTATGCTTTGCTATATACAAGTCTGCAAAACCTTTTGAAATCGATAAT
CATAATTCAAAGCGTAAACC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy