Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR267 IGR272 IGR269 IGR271 IGR270 IGR273 IGR274 IGR268 IGR275 CPn0332 ltuB, - CPn0333 CPn0330 CPn0331 rl28, - CPn0327 folD, - CPn0335 CPn0329 copN,sctW,lcrE, - CPn0324 malQ, - CPn0326 CPn0328 CPn0332 ltuB, - CPn0333 CPn0330 CPn0331 rl28, - CPn0327 folD, - CPn0335 CPn0329 copN,sctW,lcrE, - CPn0324 malQ, - CPn0326 CPn0328 Type: tandem, Name:  - 4 ltuB, - CPn0333 CPn0330 CPn0331 CPn0332 rl28, - CPn0327 CPn0329 copN,sctW,lcrE, - CPn0324 malQ, - CPn0326 CPn0328 sycE, - CPn0325 CPn0334 sycE, - CPn0325 folD, - CPn0335 CPn0334

IGS ID: IGR270

DNA Molecule Name:
1  

IGS Start:
374996

IGS Stop:
375087

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAGAATCTTATTCTATTAAACGTTTAATTAAATTAGTTATTTTTATTTT
TAAAAATATATAAAAACAAAAAAGCTATTTTAAGAGTAAAAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy