Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR260 IGR257 IGR259 IGR258 IGR256 IGR261 lgt,umpA, - CPn0311 trxB, - CPn0314 dnaA, - CPn0309 CPn0310 glgP, - CPn0307 CPn0308 acpS, - CPn0313 CPn0312 rs1, - CPn0315 lgt,umpA, - CPn0311 trxB, - CPn0314 dnaA, - CPn0309 CPn0310 glgP, - CPn0307 CPn0308 acpS, - CPn0313 CPn0312 rs1, - CPn0315 lgt,umpA, - CPn0311 trxB, - CPn0314 dnaA, - CPn0309 CPn0310 glgP, - CPn0307 CPn0308 CPn0312 rs1, - CPn0315 acpS, - CPn0313

IGS ID: IGR258

DNA Molecule Name:
1  

IGS Start:
353434

IGS Stop:
353571

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTGATAAACTCTAAAAATTAAACTTAAGAGGTCAAAATATCATAAACCCA
CATTATCTCCCAAAGGAGAATCTCTCAATACAGGTCTCTTATTGTGATAG
ACTGTAAAATTCTAAAGTCTCATGCCAAAAAGATGCTG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy