Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR246 IGR247 IGR241 IGR248 IGR242 IGR244 IGR240 IGR245 IGR249 IGR243 acpP, - CPn0295 fabG, - CPn0296 fabD,tfpA, - CPn0297 fabH, - CPn0298 CPn0294 incB, - CPn0291 recR, - CPn0299 incC, - CPn0292 CPn0300 CPn0293 acpP, - CPn0295 fabG, - CPn0296 fabD,tfpA, - CPn0297 fabH, - CPn0298 CPn0294 incB, - CPn0291 recR, - CPn0299 incC, - CPn0292 CPn0300 CPn0293 Type: tandem, Name:  - 3 acpP, - CPn0295 fabG, - CPn0296 fabD,tfpA, - CPn0297 fabH, - CPn0298 CPn0294 incB, - CPn0291 recR, - CPn0299 incC, - CPn0292 CPn0300 CPn0293

IGS ID: IGR244

DNA Molecule Name:
1  

IGS Start:
333506

IGS Stop:
333623

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAAGACAAAATAAATCTTTCTAGATGAGCTACTCTATAGAAAAAAAGGCA
CGCCGTAATCACTATTGAAAAACAATAGCTTTAAAAAAGATTACGACGCA
CCCAGAATATAAGAAAGT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy