Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR227 IGR230 IGR226 IGR232 IGR229 IGR228 IGR231 CPn0276 CPn0277 CPn0278 dppF, - CPn0280 gyrB, - CPn0275 gyrA, - CPn0274 dhnA, - CPn0281 xasA, - CPn0282 CPn0276 CPn0277 CPn0278 dppF, - CPn0280 gyrB, - CPn0275 gyrA, - CPn0274 dhnA, - CPn0281 xasA, - CPn0282 CPn0277 CPn0278 dppF, - CPn0280 gyrB, - CPn0275 gyrA, - CPn0274 CPn0279 CPn0279 CPn0276 dhnA, - CPn0281 xasA, - CPn0282

IGS ID: IGR228

DNA Molecule Name:
1  

IGS Start:
311138

IGS Stop:
311400

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATCCTACCTGAAGAATAACACAGCGCATATCACAAAAACACAGATTTATC
AAATTGAGAGACCTTTATGTCTCGTCTTTTCTCTGTTTTTCTTTATGATC
AGTTTTTAAATAAAGTTTTAATAACATGCTGCATCAAAAGAAACTTCTTA
TATCCACAGAAACGAAAAAAGTCAATAAGACGAAGAGGAATTCTTATGAT
AAAAATCCCTTTTAGGGGCTGTAAAGATGTTAAGAGAGCAGTAAACACAC
ATGTCGTTACATG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy