Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA_Thr_2 tRNA_Tyr_1 IGR210 IGR216 IGR209 IGR212 IGR213 IGR215 IGR211 IGR214 rl33, - CPn0250 CPn0260 CPn0254 CPn0255 CPn0257 CPn0256 CPn0249 ydaO, - CPn0261 surE, - CPn0262 CPn0251 rl33, - CPn0250 CPn0260 CPn0254 CPn0255 CPn0257 CPn0256 CPn0249 ydaO, - CPn0261 surE, - CPn0262 CPn0251 CPn0260 CPn0254 CPn0255 CPn0257 CPn0256 CPn0249 rl33, - CPn0250 ydaO, - CPn0261 surE, - CPn0262 CPn0251

IGS ID: IGR213

DNA Molecule Name:
1  

IGS Start:
290166

IGS Stop:
290394

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GATAACTTTTAATAAAGTTTAATTTATCAACTCAAAATCAAATTAATAAT
ATTAAGTCAAATTATTAAATTTAAAATATAGAAAAGATAAGAATCAGAAA
ATATTCAAACTTAAGAAAAGGGATTCAATAAAAATGAGTGTGAATAACCG
TAAGAAATAGAAGCCAAGTGATATAAGGAAATCGAACTCCAAGCATCGTT
AGTTTCTAACAATACTTGGAGTTCGATGA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy