Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA_Met_2 tRNA_Met_3 IGR135 IGR133 IGR130 IGR138 IGR132 IGR136 IGR131 IGR137 IGR129 IGR134 CPn0155 CPn0159 CPn0156 CPn0157 CPn0158 CPn0161 CPn0162 pfpA, - CPn0160 CPn0163 CPn0164 leuS, - CPn0153 CPn0155 CPn0159 CPn0156 CPn0157 CPn0158 CPn0161 CPn0162 pfpA, - CPn0160 CPn0163 CPn0164 leuS, - CPn0153 Type: tandem, Name:  - 2 CPn0156 CPn0158 CPn0161 CPn0162 pfpA, - CPn0160 CPn0155 CPn0159 CPn0157 CPn0164 leuS, - CPn0153 kdtA,gseA, - CPn0154 kdtA,gseA, - CPn0154 CPn0163

IGS ID: IGR134

DNA Molecule Name:
1  

IGS Start:
201773

IGS Stop:
202123

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GGAGAAAATCCGAGTTGCAGTTTCTCCTCCAAAACAACACTAAGAGTCGA
GTTTACTCATAAGCCCAGCTTGCCAGTTCGGGCAGATGCCTGGAGAAAAA
GAGTATATGTTGCTCATAAACAATCCCTTTTAAAGAATTAGCCATCTTAT
TTTATAAATTTTCTGATTCTATAAGTCTTAGTTGAGAATTTTAATTTTTA
ATATAGATGTTTTTTTAAAGCTTAAGAAATCTTAACACAAAAGAGCCGTT
CCTTTGCATCTAGCTTAGAATATTCTTATAGGAATGGACAGGTTGTCAGA
GTAGAGGCGAATGCGTTTGATTTTCCCAAAGCAGGGTCAAAGGTCGTTGA
T



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy