Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR117 IGR116 IGR115 IGR118 IGR120 IGR121 IGR114 IGR119 CPn0142 yqgE, - CPn0139 rpiA, - CPn0141 CPn0143 hemL, - CPn0138 CPn0146 CPn0145 clpB, - CPn0144 CPn0142 yqgE, - CPn0139 rpiA, - CPn0141 CPn0143 hemL, - CPn0138 CPn0146 CPn0145 clpB, - CPn0144 yqgE, - CPn0139 rpiA, - CPn0141 CPn0143 hemL, - CPn0138 yqdE, - CPn0140 yqdE, - CPn0140 CPn0142 CPn0146 CPn0145 clpB, - CPn0144

IGS ID: IGR119

DNA Molecule Name:
1  

IGS Start:
177336

IGS Stop:
177962

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GATTGTCCTCCTTCAGACTAGTGAAATGGAAAGAGCTAAGTAGAAAAACG
TCGAATTTTCTATAGGATTAAAAATAAGAATAAACAAGTTATAGGCGTTT
CTGAAAGACAGAATCGTTACTTAATACTTTCCACAATGTTCTAGCATTTA
AGAACATAGGATATATTTTGTCCAACTATAACTAGATCATTTAAAAATAT
TTGTAATTTAGTTGGAATATATAAAATCATTAGCATTAAGCAAACTGTTT
TTCTTTTCTTAGTTTTTAGATGCGAATAATTTGATAATTTCTCAGGTAAT
TAAAAATCTTTTAATTGTTTTTTCTGTTTATGTTTGACAAGCACAAGGTG
GATGCCACTCTATAGTCACGATCTTTAAGTCCTTGATTTGTGAAGAAATT
GGTCCTTAGGAGTTGCCGCTTTCTTCAGACAGTTCAAGAGATCACTTCCT
AATGTATTTTTAGAAAGGGGAAAGAGATCCTCTTAGGTTAGACGTTTAGG
TTTGGTAGTATTTCGATAGGGTTTGATAAAGTTGCCTCTTCTACATTCTC
AGAGGAAAGTTTATAGATTTTTTATTATTCCTATGTAATAAGAAAAACCT
TTTTAAAAAGTGCTTGGGGTGAATTTT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy