Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR117 IGR116 IGR111 IGR115 IGR113 IGR112 IGR118 IGR114 IGR119 CPn0142 groES, - CPn0135 yqgE, - CPn0139 rpiA, - CPn0141 ybgI, - CPn0137 CPn0143 hemL, - CPn0138 groEL, - CPn0134 pepF, - CPn0136 clpB, - CPn0144 CPn0142 groES, - CPn0135 yqgE, - CPn0139 rpiA, - CPn0141 ybgI, - CPn0137 CPn0143 hemL, - CPn0138 groEL, - CPn0134 pepF, - CPn0136 clpB, - CPn0144 yqgE, - CPn0139 rpiA, - CPn0141 ybgI, - CPn0137 CPn0143 hemL, - CPn0138 groEL, - CPn0134 pepF, - CPn0136 yqdE, - CPn0140 yqdE, - CPn0140 CPn0142 groES, - CPn0135 clpB, - CPn0144

IGS ID: IGR115

DNA Molecule Name:
1  

IGS Start:
174020

IGS Stop:
174089

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GGAATTTCTTTTAGTGAGTTTCCACATATTTTGGAGAAGCTGATCTTTAA
TGGCTAGAAAAAGCCGTGAG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy