Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA_Asn_1 IGR109 IGR106 IGR107 IGR104 IGR110 IGR105 IGR103 IGR108 CPn0130 CPn0129 CPn0133 CPn0127 groEL, - CPn0134 bpl, - CPn0128 CPn0132 CPn0131 CPn0126 CPn0130 CPn0129 CPn0133 CPn0127 groEL, - CPn0134 bpl, - CPn0128 CPn0132 CPn0131 CPn0126 CPn0129 CPn0133 CPn0127 groEL, - CPn0134 CPn0130 bpl, - CPn0128 CPn0132 CPn0131 CPn0126

IGS ID: IGR107

DNA Molecule Name:
1  

IGS Start:
163718

IGS Stop:
163747

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATGGATATGAGAAAGGATATACTGTTCATC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy