Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR103 IGR97 IGR102 IGR94 IGR100 IGR101 IGR96 IGR98 IGR99 IGR95 CT120 incA, - CT119 CT117 CT116 CT115 accB, - CT123 CT118 rpe,araD, - CT121 accC, - CT124 CT114 clpB, - CT113 CT120 incA, - CT119 CT117 CT116 CT115 accB, - CT123 CT118 rpe,araD, - CT121 accC, - CT124 CT114 clpB, - CT113 CT120 incA, - CT119 CT116 CT115 accB, - CT123 CT118 rpe,araD, - CT121 accC, - CT124 CT114 clpB, - CT113 efp1, - CT122 efp1, - CT122 CT117

IGS ID: IGR98

DNA Molecule Name:
1  

IGS Start:
136159

IGS Stop:
136247

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGGCAAAACTCGAAAAGCAGACTTCCTCTAGGTCTGCTAGCTCTTTTAA
TGACAAGAAACGAAATTTGATAAAGGGATAGGGGGATAC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy