Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Val-2 IGR692 IGR697 IGR695 IGR696 IGR689 IGR691 IGR693 IGR690 IGR694 IGR688 CT832 murB, - CT831 rl35, - CT834 rl20, - CT835 yggH, - CT829 infC, - CT833 ytgB, - CT830 pheS, - CT836 nrdB, - CT828 nrdA, - CT827 CT832 murB, - CT831 rl35, - CT834 rl20, - CT835 yggH, - CT829 infC, - CT833 ytgB, - CT830 pheS, - CT836 nrdB, - CT828 nrdA, - CT827 CT832 murB, - CT831 rl20, - CT835 yggH, - CT829 infC, - CT833 ytgB, - CT830 pheS, - CT836 nrdB, - CT828 nrdA, - CT827 rl35, - CT834

IGS ID: IGR690

DNA Molecule Name:
1  

IGS Start:
978594

IGS Stop:
978966

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGTCCTGATATCAAAATAGGAGAAAGCCTCAACCATAGAGTTGAGGCTT
TTTTTTGTCATACGGTAACCTGATAAGAATTTTTAGATTTTCAGGTTAGA
AGTAAATGTATTTACCCATGAATTTTTTTTAATTTTCTCATAATATCTTG
TAGCCCTTTTATTAAAATGGAAAAGGCTAGTCACCTCTCCTATGACTACT
GTTAGAGTGGTGAGGTTTGGGGTTGGAGCAGGTGTAGCCTTTCGCATACG
AAGTATTTTCCTGTGAAACCACAAGATTTGAAACTTCCCTATTTTTGGGA
AGAACGCTCTCCTCAAATAGCAAACCATGTATTTTATGTACCCAATTACT
ATTCTCGATACGAAGAGTTTGTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy