Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Gly-1 tRNA-Thr-3 tRNA-Lys-1 tRNA-Glu-1 IGR560 IGR558 IGR561 IGR559 IGR562 rrf, - CT677 pyrH, - CT678 rs2, - CT680 tsf, - CT679 karG, - CT675 omp1,ompA, - CT681 pkn5, - CT673 yscC,sctC, - CT674 rrf, - CT677 pyrH, - CT678 rs2, - CT680 tsf, - CT679 karG, - CT675 omp1,ompA, - CT681 pkn5, - CT673 yscC,sctC, - CT674 rrf, - CT677 pyrH, - CT678 rs2, - CT680 tsf, - CT679 karG, - CT675 omp1,ompA, - CT681 CT676 CT676 pkn5, - CT673 yscC,sctC, - CT674

IGS ID: IGR559

DNA Molecule Name:
1  

IGS Start:
775160

IGS Stop:
775532

Features:
tRNA-Glu-1  tRNA-Lys-1  

Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATCGAAAGCCGTGCAGATACAACGAGGTACTTTCAGCAATAACAGAAAAA
AACAAAGGAAGGAAATCTTTTTGATGAGGAGGGAAGATCTCTTAGAGAAA
GAAATGGGTCTTGAAGGATTCGAACCTTCGACCCTCTCATTAAAAGTGAG
ATGCTCTAACCGCTGAGCTAAAGACCCGCATTTCTTTTTGTAATGACCCC
AAGGGGATTCGAACCCCTGTTACCGGAATGAAAATCCGATGTCCTGGGCC
AGGCTAGACGATGGGGCCAGGACGGGTCTAATGTTATCACTAAACCCTTT
TTTTCTGCAACTTTTTCTGTTCTCTAACGCATTTATTTTTAGAGAATAGG
GAAGTTGCACAGAAGCATAACTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy