Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR510 IGR512 IGR509 IGR511 CT623 CT622 CT621 CT619 CT620 CT623 CT622 CT621 CT619 CT620 CT623 CT622 CT621 CT619 CT620

IGS ID: IGR510

DNA Molecule Name:
1  

IGS Start:
704288

IGS Stop:
704356

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGACAAATAAAGCAGCTTAAAAATTTTTGTTTTTAAGCTGCTTTCCCTC
ACGATTATTACTGAAGCTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy