Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR504 IGR508 IGR509 IGR505 IGR507 IGR506 folX, - CT614 CT616 folP, - CT613 rpoD, - CT615 CT619 rs20, - CT617 CT618 CT620 folX, - CT614 CT616 folP, - CT613 rpoD, - CT615 CT619 rs20, - CT617 CT618 CT620 folX, - CT614 CT616 folP, - CT613 rpoD, - CT615 CT619 rs20, - CT617 CT618 CT620

IGS ID: IGR507

DNA Molecule Name:
1  

IGS Start:
697935

IGS Stop:
698169

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAATTTTTTCTATTCTTTCCTAATTAATCATCTTAGGTCCAAAAAGCTGA
TGAACACGCTCACTTTCTGAGGCTTTTTGGATCGTTTCTTGTCGATAAAG
ATTTTATTTGCATCGATTTAAAAGCGATTTCTTTTTACAATGCTTTCCCG
ATATGCCTCCTTTTGAGTCATAAACCTTTGGTTTCACAAGATTTTTGACG
CAAAAGGCCCTTAATTTTTTTTGGAGGTTTCCACA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy