Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Leu-4 IGR442 IGR438 IGR445 IGR444 IGR440 IGR439 IGR441 IGR446 IGR437 IGR443 spoU,yibK, - CT540 fabZ, - CT532 vldD,yciA, - CT535 CT538 mip, - CT541 dnaQ, - CT536 lpxC, - CT533 fmt, - CT530 cutE,lnt, - CT534 aspS, - CT542 trxA, - CT539 spoU,yibK, - CT540 fabZ, - CT532 vldD,yciA, - CT535 CT538 mip, - CT541 dnaQ, - CT536 lpxC, - CT533 fmt, - CT530 cutE,lnt, - CT534 aspS, - CT542 trxA, - CT539 spoU,yibK, - CT540 fabZ, - CT532 vldD,yciA, - CT535 CT538 dnaQ, - CT536 lpxC, - CT533 fmt, - CT530 cutE,lnt, - CT534 aspS, - CT542 CT537 lpxA, - CT531 CT537 lpxA, - CT531 mip, - CT541 trxA, - CT539

IGS ID: IGR440

DNA Molecule Name:
1  

IGS Start:
602682

IGS Stop:
602747

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAAGGGGCTCCCTTACTAGCTTACATTCAAGATGAGAGAAAAAGAATCC
CCTTAGAAGTTACTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy