Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR432 IGR435 IGR430 IGR438 IGR434 IGR431 IGR433 IGR440 IGR439 IGR437 IGR436 rs19, - CT524 rl22, - CT523 rl23, - CT526 fabZ, - CT532 vldD,yciA, - CT535 rl3, - CT528 rl4, - CT527 rs3, - CT522 rl2, - CT525 lpxC, - CT533 CT529 fmt, - CT530 cutE,lnt, - CT534 rs19, - CT524 rl22, - CT523 rl23, - CT526 fabZ, - CT532 vldD,yciA, - CT535 rl3, - CT528 rl4, - CT527 rs3, - CT522 rl2, - CT525 lpxC, - CT533 CT529 fmt, - CT530 cutE,lnt, - CT534 rl22, - CT523 rl23, - CT526 fabZ, - CT532 rl3, - CT528 rl4, - CT527 rs3, - CT522 rl2, - CT525 lpxC, - CT533 CT529 fmt, - CT530 cutE,lnt, - CT534 lpxA, - CT531 lpxA, - CT531 rs19, - CT524

IGS ID: IGR437

DNA Molecule Name:
1  

IGS Start:
597675

IGS Stop:
597842

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATTCACCTACCTGCTTCAAAATTATGTACATACAAAATTTAGAGAGATAT
TATACCACTTCTATTACTTAAACCGAAAAAGGAAAACGCAGCAAACCCTT
CTAGAAAGGCCTCTCAGACCCAAAATAAAAAAATATTTTGACTATCTAGA
GGCGTCAAATCTTTTTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy