Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR428 IGR425 IGR432 IGR435 IGR430 IGR438 IGR426 IGR434 IGR427 IGR424 IGR431 IGR433 IGR423 IGR429 IGR437 IGR436 rs17, - CT519 rs19, - CT524 rl22, - CT523 rl24, - CT517 rl23, - CT526 rl14, - CT518 rs8, - CT515 rl16, - CT521 fabZ, - CT532 rl5, - CT516 rl6, - CT514 rl3, - CT528 rl4, - CT527 rs3, - CT522 rl2, - CT525 CT529 fmt, - CT530 rs17, - CT519 rs19, - CT524 rl22, - CT523 rl24, - CT517 rl23, - CT526 rl14, - CT518 rs8, - CT515 rl16, - CT521 fabZ, - CT532 rl5, - CT516 rl6, - CT514 rl3, - CT528 rl4, - CT527 rs3, - CT522 rl2, - CT525 CT529 fmt, - CT530 rl22, - CT523 rl23, - CT526 rl14, - CT518 rl5, - CT516 rl6, - CT514 rl3, - CT528 rl4, - CT527 rs3, - CT522 rl2, - CT525 CT529 fmt, - CT530 rl29, - CT520 lpxA, - CT531 rl16, - CT521 fabZ, - CT532 lpxA, - CT531 rs17, - CT519 rs19, - CT524 rl24, - CT517 rs8, - CT515 rl29, - CT520

IGS ID: IGR433

DNA Molecule Name:
1  

IGS Start:
594627

IGS Stop:
594652

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GTTATTCTTCTCTTCCTTCTTTACTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy