Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR326 IGR329 IGR328 IGR327 IGR331 IGR330 yprS, - CT392 grpE, - CT395 CT398 CT391 hrcA, - CT394 proS, - CT393 dnaK, - CT396 vacB, - CT397 yprS, - CT392 grpE, - CT395 CT398 CT391 hrcA, - CT394 proS, - CT393 dnaK, - CT396 vacB, - CT397 yprS, - CT392 grpE, - CT395 CT398 CT391 hrcA, - CT394 proS, - CT393 dnaK, - CT396 vacB, - CT397

IGS ID: IGR329

DNA Molecule Name:
1  

IGS Start:
451586

IGS Stop:
451613

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAATTATCCTAGAAATTAGGTGTTCAAT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy