Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR325 IGR326 IGR329 IGR328 IGR324 IGR323 IGR327 CT388 yprS, - CT392 grpE, - CT395 CT391 hrcA, - CT394 aspC, - CT390 CT389 proS, - CT393 dnaK, - CT396 CT388 yprS, - CT392 grpE, - CT395 CT391 hrcA, - CT394 aspC, - CT390 CT389 proS, - CT393 dnaK, - CT396 CT388 yprS, - CT392 grpE, - CT395 CT391 hrcA, - CT394 aspC, - CT390 CT389 proS, - CT393 dnaK, - CT396

IGS ID: IGR327

DNA Molecule Name:
1  

IGS Start:
447827

IGS Stop:
448026

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GGAGATTTAAAAACAAAATTTGCAAAAACGCTTAAATTAATTTTAAGAAA
CAAACAAAAGAAACATCAAGTTATTAAGAAATAAAGAATCTGAACTAGTT
AAAATCCAATAAGAACAAAAAAATCACAGAGATTGATCTAGAAACACTCC
TATGCTAAGATGCTCTTCCACACGAAACAATATAAAGCACTTCCTTCCCT




Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy