Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR325 IGR326 IGR322 IGR324 IGR323 IGR327 IGR321 CT388 CT386 yprS, - CT392 CT391 aspC, - CT390 CT389 proS, - CT393 CT387 CT388 CT386 yprS, - CT392 CT391 aspC, - CT390 CT389 proS, - CT393 CT387 CT388 CT386 yprS, - CT392 CT391 aspC, - CT390 CT389 proS, - CT393 CT387

IGS ID: IGR324

DNA Molecule Name:
1  

IGS Start:
444378

IGS Stop:
444469

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGCTTTTCTCAGTGCTCTCTAAAAATTACGCTGGACAGATGAGAGTCTC
ATCTTTATATTACCGTCCACCATTTTGACTCTCCCGTGTTTC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy