Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR303 IGR305 IGR304 dapB, - CT364 lysC, - CT362 CT365 aroC, - CT368 aroA, - CT366 aroE,aroD, - CT370 dapB, - CT364 lysC, - CT362 CT365 aroC, - CT368 aroA, - CT366 aroE,aroD, - CT370 dapB, - CT364 lysC, - CT362 CT365 asd, - CT363 asd, - CT363 aroC, - CT368 aroA, - CT366 aroE,aroD, - CT370 aroL, - CT367 aroB, - CT369 aroL, - CT367 aroB, - CT369

IGS ID: IGR305

DNA Molecule Name:
1  

IGS Start:
417902

IGS Stop:
418070

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAAAAAACATAAAATCTTTCAACAAGATTAATTATAACAACAAAATAAAA
TCCTTTTCATAACAAAAAAATAGAACTTATTTCCCTCGTATGATCTTAAA
TATCATGCAAAAAACTCTTCCGAAGACTACATTAGCTATTCATTTTTAAC
CTTTTTAGAAAATAGACAT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy