Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Ser-1 IGR303 IGR302 IGR295 IGR298 IGR299 IGR301 IGR300 IGR296 IGR297 CT357R bioY, - CT359 CT360 dapB, - CT364 kgsA, - CT354 dapA, - CT361 CT355 lysC, - CT362 CT356 CT357 CT358 CT357R bioY, - CT359 CT360 dapB, - CT364 kgsA, - CT354 dapA, - CT361 CT355 lysC, - CT362 CT356 CT357 CT358 CT357R bioY, - CT359 CT360 kgsA, - CT354 dapA, - CT361 CT355 lysC, - CT362 CT356 asd, - CT363 asd, - CT363 dapB, - CT364 CT358 CT357

IGS ID: IGR299

DNA Molecule Name:
1  

IGS Start:
410372

IGS Stop:
410436

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAATGCAGCTTGCTCTTCTACCCTTAGAGGGCCTTGGACAGAAGGGCTCT
CTTCGGAAAATCTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy