Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR256 IGR259 IGR257 IGR255 IGR258 IGR254 CT312 atpE, - CT310 tal, - CT313 atpA, - CT308 rpoB, - CT315 rpoC, - CT314 CT311 CT312 atpE, - CT310 tal, - CT313 atpA, - CT308 rpoB, - CT315 rpoC, - CT314 CT311 CT312 atpE, - CT310 tal, - CT313 atpA, - CT308 rpoB, - CT315 rpoC, - CT314 CT309 CT309 CT311

IGS ID: IGR258

DNA Molecule Name:
1  

IGS Start:
350376

IGS Stop:
350489

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAACACCTTGTCAATTTTTGACTTTAAGTGAAGCCTACCAAAAAAAACGA
TACTATTCAAGGGGGTTATGACTCATACCCCCTCTCTTTCTCTAGTTTTT
GGGGCAGATCTTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy