Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR253 IGR252 IGR249 IGR251 IGR250 CT303 atpB, - CT307 atpA, - CT308 atpI,ntpI, - CT305 pknD, - CT301 valS, - CT302 CT303 atpB, - CT307 atpA, - CT308 atpI,ntpI, - CT305 pknD, - CT301 valS, - CT302 atpB, - CT307 atpA, - CT308 atpI,ntpI, - CT305 pknD, - CT301 valS, - CT302 atpK, - CT304 atpD, - CT306 atpD, - CT306 CT303 atpK, - CT304

IGS ID: IGR251

DNA Molecule Name:
1  

IGS Start:
340876

IGS Stop:
340919

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTTCTATTTTTTTCAAAAAAACGCACATCAACCTTCTGGATTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy