Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR241 IGR240 IGR235 IGR242 IGR239 IGR238 IGR237 IGR236 dut, - CT292 ptsN, - CT291 ptsN, - CT290 lplA, - CT285 accD, - CT293 ycbF,trmU, - CT287 CT289 CT284 CT288 clpC, - CT286 dut, - CT292 ptsN, - CT291 ptsN, - CT290 lplA, - CT285 accD, - CT293 ycbF,trmU, - CT287 CT289 CT284 CT288 clpC, - CT286 ptsN, - CT291 ptsN, - CT290 accD, - CT293 ycbF,trmU, - CT287 CT289 CT284 dut, - CT292 lplA, - CT285 CT288 clpC, - CT286

IGS ID: IGR237

DNA Molecule Name:
1  

IGS Start:
321592

IGS Stop:
321822

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AATGAACCCAGAAAACGCTTTCGTTTATTGAAGTTTGCACATTACAAAGG
GCCATCATGTTAGCAAAAAAACAGGATCAAAAAAACCTATTTCTCAAGCC
GCCTCTTTTAAATCTTAATTACAAAAAGACAAATCAATTCAATTTTTCAA
AAAAGAATTTAAACATTAATTGTTGTAAAAAAACAATATTTATTCTAAAA
TAATAACCACAGTTACGGGGAAATCTCTTTC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy