Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR230 IGR235 IGR231 IGR233 IGR232 IGR234 IGR236 gcsH,gcvT, - CT282 lplA, - CT285 CT284 CT283 nqr5, - CT281 CT279 nqr2, - CT278 clpC, - CT286 gcsH,gcvT, - CT282 lplA, - CT285 CT284 CT283 nqr5, - CT281 CT279 nqr2, - CT278 clpC, - CT286 gcsH,gcvT, - CT282 lplA, - CT285 CT284 CT283 nqr5, - CT281 nqr2, - CT278 clpC, - CT286 nqr4, - CT280 nqr4, - CT280 CT279

IGS ID: IGR234

DNA Molecule Name:
1  

IGS Start:
315386

IGS Stop:
315558

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TCCTTTTAAGAAAAAAAAGGAAAACTACTTCTACAGAATTCCTTTACGAA
GAGAGAAAGAGATCCCTCTAGAATATCTCATGGTACTTGTTGCGTAAGAT
TATTATCAAGTTTTCATGGACAAAGACCGAAGGGAGGATCTGTACAGATC
CTCCCTCCCTATTAGAAGAGTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy