Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR203 IGR205 IGR206 IGR208 IGR209 IGR207 IGR204 CT244 dnaA, - CT250 CT251 glgP, - CT248 CT249 pdhA,odpA, - CT245 firA,lpxD, - CT243 pdhC,aceF, - CT247 CT244 dnaA, - CT250 CT251 glgP, - CT248 CT249 pdhA,odpA, - CT245 firA,lpxD, - CT243 pdhC,aceF, - CT247 CT244 dnaA, - CT250 CT251 glgP, - CT248 CT249 pdhA,odpA, - CT245 firA,lpxD, - CT243 pdhC,aceF, - CT247 odpB,pdhB, - CT246 odpB,pdhB, - CT246

IGS ID: IGR206

DNA Molecule Name:
1  

IGS Start:
276856

IGS Stop:
276887

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAAGAAGGGAATGTTTCCCTTCTTTCTTCTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy