Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR103 IGR109 IGR102 IGR105 IGR106 IGR107 IGR108 IGR104 adk, - CT128 ydhO, - CT127 CT131 rs9, - CT126 rl13, - CT125 accB, - CT123 glnP, - CT129 rpe,araD, - CT121 glnQ, - CT130 accC, - CT124 adk, - CT128 ydhO, - CT127 CT131 rs9, - CT126 rl13, - CT125 accB, - CT123 glnP, - CT129 rpe,araD, - CT121 glnQ, - CT130 accC, - CT124 adk, - CT128 ydhO, - CT127 CT131 rs9, - CT126 rl13, - CT125 accB, - CT123 glnP, - CT129 rpe,araD, - CT121 glnQ, - CT130 accC, - CT124 efp1, - CT122 efp1, - CT122

IGS ID: IGR107

DNA Molecule Name:
1  

IGS Start:
143261

IGS Stop:
143358

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GGGAGAACCTCGGTAGAGACATCACAAAGAGGACTAAAAAGAGGTTCTTA
GTCCTTGTTGAACACGACTATACCAAAGAAATTCTTTTCCGTATTCTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy