Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR11 IGR12 IGR9 IGR14 IGR13 IGR8 IGR10 ybbP, - CT012 rnhB, - CT008 CT011 phoH, - CT015 htrB, - CT010 yfgA, - CT009 CT016 cydB, - CT014 cydA, - CT013 ybbP, - CT012 rnhB, - CT008 CT011 phoH, - CT015 htrB, - CT010 yfgA, - CT009 CT016 cydB, - CT014 cydA, - CT013 ybbP, - CT012 rnhB, - CT008 CT011 phoH, - CT015 htrB, - CT010 yfgA, - CT009 CT016 cydB, - CT014 cydA, - CT013

IGS ID: IGR10

DNA Molecule Name:
1  

IGS Start:
13338

IGS Stop:
13611

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
CTATATAAGATAACCCTAGCAGTTGAAGTGTTTTCATTATTTTCAGCAAA
ACAAGAAGCTGTACCAACTCCTTGAAACTTATTACGGATGAACCGAAGTC
AAGGAAGGTCTTAAGAAGGCCTTTGGGAAAGGACTCATCCCTAGTTTAGC
TGGAAGACAGTTAATGGCAAAGTATTTTGTGGAAAAGGGCTGTTTTAACA
ACTGGTGACAGGGAAACGTGCATAGTATATATACTAAAAAGAATACTAGA
AGTTTTTGATTTGGAGAGCCAAAT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy