Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results

Record: 1 of 1  
MiniMap tRNA-Glu-3 rRNA-16S-6 rRNA-23S-6 IGR1402 IGR1404 IGR1407 IGR1405 IGR1406 IGR1408 IGR1403 IGR1401 IGR1400 udp, - HD1908 udp, - HD1909 asnC, - HD1911 udp, - HD1907 HD1915 murI, - HD1906 HD1916 proS, - HD1919 HD1912 yhdM, - HD1917 asnA, - HD1913 udp, - HD1908 udp, - HD1909 asnC, - HD1911 udp, - HD1907 HD1915 murI, - HD1906 HD1916 proS, - HD1919 HD1912 yhdM, - HD1917 asnA, - HD1913 udp, - HD1909 asnC, - HD1911 udp, - HD1907 HD1915 murI, - HD1906 HD1916 proS, - HD1919 udp, - HD1908 HD1912 yhdM, - HD1917 asnA, - HD1913 HD1918 HD1918
* Calculated from Protein Sequence

Gene ID: HD1908

DNA Molecule Name:
1  

Genbank ID:
0

Gene Name:
udp  

Definition:
uridine phosphorylase fragment

Gene Start:
1607975

Gene Stop:
1607871

Gene Length:
105

Molecular Weight*:
3626

pI*:
4.50

Net Charge*:
-1.12

EC:
2.4.2.3  

Functional Class:
Purines, pyrimidines, nucleosides, and nucleotides; Salvage of nucleosides and nucleotides  

Pathway: pathway table
Pyrimidine metabolism

Secondary Evidence:
Walton,L., Richards,C.A. and Elwell,L.P.
Nucleotide sequence of the Escherichia coli uridine phosphorylase
udp) gene
Nucleic Acids Res. 17 (16), 6741 (1989)
MEDLINE: 89386014

Comment:
See HD1907, HD1909.

Blast Summary:  PSI-Blast Search
Some weakly significant hits using gapped BLAST to from H. influenzae (1174872), E. coli (136740), Salmonella typhimurium (3122988, 2168160), among others.

No similarities to C. trachomatis, C. pneumoniae, U. urealyticum, T. pallidum, M. genitalium, or M. pneumoniae.

COGS Summary:  COGS Search
No hits to the COGs database.

Blocks Summary:  Blocks Search
No significant hits to the Blocks database.

ProDom Summary:  Protein Domain Search
Residues 1-34 are 88% similar to a (PHOSPHORYLASE NUCLEOSIDASE COMPLETE PROTEOME) protein domain (PD003928) which is seen in Q9CKN8_PASMU.



Paralogs:  Local Blast Search
HD1908 has no significant similarity (blastp p-value < 1e-3) to any other gene in this genome.


Pfam Summary:  Pfam Search
No significant hits to the Pfam 11.0 database

PDB Hit:
No significant hits to the NCBI PDB database.

Gene Protein Sequence:
VSICVEELAQLGVRTFLRVGTTCAIQPQINVGDI$

Gene Nucleotide Sequence:  Sequence Viewer
GTGTCAATTTGTGTCGAAGAGTTAGCTCAACTTGGTGTGCGAACTTTCTT
ACGTGTCGGTACAACCTGCGCTATTCAACCGCAGATTAACGTAGGTGATA
TTTAG


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy