Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results

Record: 1 of 1  
MiniMap tRNA-Pro-1 tRNA-Arg-2 IGR809 IGR811 IGR813 IGR807 IGR814 IGR810 IGR812 IGR808 IGR806 IGR815 IGR805 HD1119 nth, - HD1115 fdoI,fdxI, - HD1111 HD1117 fdhE, - HD1110 sms,radA, - HD1121 HD1120 pilA,ppdD, - HD1123 folA,dyr, - HD1118 fdhD, - HD1113 folD, - HD1108 dapA, - HD1107 HD1109 HD1119 nth, - HD1115 fdoI,fdxI, - HD1111 HD1117 fdhE, - HD1110 sms,radA, - HD1121 HD1120 pilA,ppdD, - HD1123 folA,dyr, - HD1118 fdhD, - HD1113 folD, - HD1108 dapA, - HD1107 HD1109 HD1119 nth, - HD1115 fdoI,fdxI, - HD1111 HD1117 fdhE, - HD1110 sms,radA, - HD1121 fdxH, - HD1112 fdxH, - HD1112 pilA,ppdD, - HD1123 folA,dyr, - HD1118 fdhD, - HD1113 folD, - HD1108 dapA, - HD1107 HD1109 HD1120
* Calculated from Protein Sequence

Gene ID: HD1112

DNA Molecule Name:
1  

Genbank ID:
0

Gene Name:
fdxH  

Definition:
formate dehydrogenase, iron-sulfur subunit, beta chain

Gene Start:
887760

Gene Stop:
887644

Gene Length:
117

Molecular Weight*:
4288

pI*:
4.10

Net Charge*:
-7.29

EC:
1.2.1.2  

Functional Class:
Energy metabolism; Anaerobic respiration  

Pathway: pathway table
Glyoxylate and dicarboxylate metabolism
Methane metabolism

Comment:


Blast Summary:  PSI-Blast Search
One moderately weak hit in gapped BLAST to formate dehydrogenase, beta subunit (the iron-sulfur subunit); residues 3-38 are 61% similar to residues 269-304 of FDX_HAEIN [1169660].

COGS Summary:  COGS Search
No hits to the COGs database.

Blocks Summary:  Blocks Search
No significant hits to the Blocks database.

ProDom Summary:  Protein Domain Search
No significant hits to the ProDom database.

Paralogs:  Local Blast Search
HD1112 has no significant similarity (blastp p-value < 1e-3) to any other gene in this genome.


Pfam Summary:  Pfam Search
No significant hits to the Pfam 11.0 database

PDB Hit:
No significant hits to the NCBI PDB database.

Gene Protein Sequence:
MRITMGSLALAEIAHYITIGPNIEEDIEDHQNEGEQHE$

Gene Nucleotide Sequence:  Sequence Viewer
ATGAGAATTACAATGGGAAGCTTAGCGCTTGCTGAAATAGCGCACTACAT
CACCATTGGACCAAATATTGAGGAAGATATTGAAGATCATCAGAATGAAG
GAGAACAACATGAGTAA


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy