Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results

Record: 1 of 1  
MiniMap IGR272 IGR277 IGR271 IGR270 IGR273 IGR274 IGR275 IGR276 CPn0332 ltuB, - CPn0333 smpB, - CPn0337 CPn0330 CPn0331 CPn0334 yojL, - CPn0336 CPn0329 recF, - CPn0339 dnaN, - CPn0338 CPn0328 CPn0332 ltuB, - CPn0333 smpB, - CPn0337 CPn0330 CPn0331 CPn0334 yojL, - CPn0336 CPn0329 recF, - CPn0339 dnaN, - CPn0338 CPn0328 Type: tandem, Name:  - 4 ltuB, - CPn0333 smpB, - CPn0337 CPn0330 CPn0331 CPn0332 yojL, - CPn0336 CPn0329 recF, - CPn0339 dnaN, - CPn0338 CPn0328 folD, - CPn0335 folD, - CPn0335 CPn0334
* Calculated from Protein Sequence

Gene ID: CPn0332

DNA Molecule Name:
1  

Genbank ID:


Gene Name:


Definition:
hypothetical protein

Gene Start:
378655

Gene Stop:
378533

Gene Length:
123

Molecular Weight*:
4496

pI*:
7.80

Net Charge*:
1.02

EC:
 

Functional Class:
unknown; hypothetical  

Pathway: pathway table

Comment:
The defline describes this sequence as CHLTR T2 Protein, but BLAST shows insignificant similarity to CT081, the chlamydial T2 protein referred to. While residues 4-36 are 45% similar to residues 33-67 of CT081, the E-value is an extremely poor 1.1, indicating randomness. The sequence of CT0332 has been submitted to GenBank through direct submission by Kalman, et al., under the accession AAD18481 (a 40 aa CHLTR T2 protein).

Blast Summary:  PSI-Blast Search
No significant hits in gapped BLAST.
No significant similarity to C.trachomatis, T.pallidum, M.genitalium, or U.urealyticum.

COGS Summary:  COGS Search
No hit to the COGs database.

Blocks Summary:  Blocks Search
None.

ProDom Summary:  Protein Domain Search
None.

Paralogs:  Local Blast Search
No paralogs in C.pneumoniae.

Pfam Summary:  Pfam Search
No significant hits to the Pfam 11.0 database

Structural Feature(s):
Feature Type  Start  Stop
transmembrane  
16  
34

PDB Hit:


Gene Protein Sequence:
VIPLARQRCTLLHLLAVLCPPISFFTQGVSPCVFFCFLDF$

Gene Nucleotide Sequence:  Sequence Viewer
GTGATCCCTCTAGCTCGACAGCGATGCACTTTGTTGCATCTACTCGCTGT
TCTCTGTCCTCCCATAAGTTTTTTTACGCAAGGTGTTTCACCTTGCGTTT
TTTTTTGTTTTTTAGATTTTTAA


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy